If you've found a bug in clonotypeR, post about it here. TODO items go elsewhere. Link items to done when done.
The shortcut commit points to http://source.clonotyper.branchable.com/?p=source.git;a=commitdiff;h=%s.
You can use it to link to the commit that fixed the bug, as in [[!commit 7cf11805d84ff8dc6a537c17e73efa275077915d]].
There are 3 "open" bugs:
> yassai_identifier(c(V="TRAV14N-1", J="TRAJ56", dna="GCAGCTACTGGAGGCAATAATAAGCTGACT", pep="AATGGNNKLT")) [1] "aa.1A14N1A56L10"
Should be aa.A14N1A56L10.
Problem:
$ basename foo.fastq .fastq
foo
$ basename foo.FASTQ .fastq
foo.FASTQ
This would prevent horrors like:
$ ../scripts/clonotypeR detect .fastq [bam_header_read] EOF marker is absent. The input is probably truncated. [bsw2_aln] fail to open file '.fastq'. Abort! [samopen] SAM header is present: 169 sequences. [sam_read1] reference 'SN:TRDV5 LN:344 3 19 3 ' is recognized as '*'. [main_samview] truncated file.